Dataset: EZH2 over-expression is associated with gain of chromosome arm 7q and essential for cell cycle progression and a marker of poor prognosis in neuroblastoma
Neuroblastoma is an often aggressive childhood cancer with several large chromosomal regions showing recurrent gains or losses....
Neuroblastoma is an often aggressive childhood cancer with several large chromosomal regions showing recurrent gains or losses. Chromosome 7q is gained in 40-60% of neuroblastomas, but despite being the second most frequent genomic aberration, no oncogenes have been linked to 7q gain. We performed expression profiling and array CGH on 88 primary neuroblastoma tumors to identify a 7q oncogene. We assayed neuroblastoma cell lines and combined bioinformatic analyses on the in vitro and in vivo data.
- Species:
- human
- Samples:
- 9
- Source:
- E-GEOD-28409
- Updated:
- Dec.12, 2014
- Registered:
- Sep.16, 2014
Factors:
(via ArrayExpress)
Sample | TREATMENT CONDITION | SHRNA | CELL LINE | SEQUENCE |
---|---|---|---|---|
GSM702199 | EZH2 siRNA dox | not specified | IMR32 | not specified |
GSM702199 | EZH2 siRNA dox | not specified | IMR32 | not specified |
GSM70220 | EZH2 siRNA dox | not specified | SJNB8 | not specified |
GSM70220 | EZH2 siRNA dox | not specified | SJNB8 | not specified |
GSM702203 | no lenti | not specified | IMR32 | not specified |
GSM702204 | ezh2-lenti | Sigma MISSION TRCN0000040074 (EZH2) | IMR32 | GCTAGGTTAATTGGGACCAAA |
GSM702203 | no lenti | not specified | IMR32 | not specified |
GSM702206 | ezh2-lenti_2 | Sigma MISSION TRCN0000040074 (EZH2) | IMR32 | GCTAGGTTAATTGGGACCAAA |
GSM702207 | ezh2-lenti_2_control | Sigma MISSION SHC002 (control) | IMR32 | CAACAAGATGAAGAGCACCAA |