ArrayExpress Uploader0humanEZH2 siRNA doxnot specifiedIMR32not specifiedEZH2 siRNA doxnot specifiedIMR32not specifiedEZH2 siRNA doxnot specifiedSJNB8not specifiedEZH2 siRNA doxnot specifiedSJNB8not specifiedno lentinot specifiedIMR32not specifiedezh2-lentiSigma MISSION TRCN0000040074 (EZH2)IMR32GCTAGGTTAATTGGGACCAAAno lentinot specifiedIMR32not specifiedezh2-lenti_2Sigma MISSION TRCN0000040074 (EZH2)IMR32GCTAGGTTAATTGGGACCAAAezh2-lenti_2_controlSigma MISSION SHC002 (control)IMR32CAACAAGATGAAGAGCACCAA4028arrayexpress_sid4Neuroblastoma is an often aggressive childhood cancer with several large chromosomal regions showing recurrent gains or losses....E-GEOD-28409/profile/8773/arrayexpressuploader49cancercellchromosomeneuroblastomaDec.12, 2014Falseezh2-over-expression-is-associated-with-gain-of-chE-GEOD-28409_A-AFFY-44EZH2 over-expression is associated with gain of chromosome arm 7q and essential for cell cycle progression and a marker of poor prognosis in neuroblastomaSep.16, 2014Neuroblastoma is an often aggressive childhood cancer with several large chromosomal regions showing recurrent gains or losses. Chromosome 7q is gained in 40-60% of neuroblastomas, but despite being the second most frequent genomic aberration, no oncogenes have been linked to 7q gain. We performed expression profiling and array CGH on 88 primary neuroblastoma tumors to identify a 7q oncogene. We assayed neuroblastoma cell lines and combined bioinformatic analyses on the in vitro and in vivo data.http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-28409http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-28409/samples/