{"owner": "ArrayExpress Uploader", "pop_total": 0, "id": 3928, "factors": [{"GSM656344": {"SIRNA NAME": "siN", "SIRNA TARGET SEQUENCE": "AAGACUACCGUUGUAUAGUAG"}}, {"GSM656345": {"SIRNA NAME": "si463", "SIRNA TARGET SEQUENCE": "AAGGCCAUUUGUGGGUGAAAA"}}, {"GSM656346": {"SIRNA NAME": "siNs", "SIRNA TARGET SEQUENCE": "AAGACUACCGUUGUAUAGUAG"}}, {"GSM656347": {"SIRNA NAME": "si716s", "SIRNA TARGET SEQUENCE": "AAGAUGACCUCACACUGCUUGAUAA"}}], "ownerprofile_id": "arrayexpress_sid", "platform": 4, "summary_wrapped": "Kaposi\u2019s sarcoma-associated hepesvirus (KSHV) encodes four genes with homology to human interferon regulatory factors (IRFs). One of...", "pubmed_id": 21345951, "geo_gse_id": "E-GEOD-26661", "owner_profile": "/profile/8773/arrayexpressuploader", "factor_count": 2, "sample_count": 4, "tags": ["cell", "line", "sarcoma"], "lastmodified": "Dec.12, 2014", "is_default": false, "geo_id_plat": "E-GEOD-26661_A-AFFY-44", "slug": "knockdown-of-kshv-viral-interferon-regulatory-fact", "geo_gds_id": "", "name": "Knockdown of KSHV viral interferon-regulatory factor 3 (vIRF-3) in primary effusion lymphoma (PEL) cells by RNA-Interference", "created": "Sep.15, 2014", "summary": "Kaposi\u2019s sarcoma-associated hepesvirus (KSHV) encodes four genes with homology to human interferon regulatory factors (IRFs). One of these IRFs, the viral interferon regulatory factor 3 (vIRF-3) is expressed in latently infected PEL cells and required for their continuous proliferation. Moreover, vIRF-3 is known to be involved in modulation of the type I interferon response. In order to identify cellular genes regulated by vIRF-3, cells from the PEL cell line BC-3 (KSHV positive) were transfected with either siRNAs targeted at vIRF-3 (si463 or si716s) or a negative control siRNA without homology to a known gene (siN, siNs). A total of 4 samples were analyzed. This includes two samples with silencing of vIRF-3 expression via RNA-interference (si463 or si716s) and two samples transfected with a negative-control siRNA (siN, siNs). Expression of vIRF-3 was reduced by approximately 75% as estimated by Western blot analysis.", "source": "http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-26661", "species": "human", "sample_source": "http://www.ebi.ac.uk/arrayexpress/experiments/E-GEOD-26661/samples/"}